circad | circRNAs associated with diseases

hsa_circ_0005986
Gene	PRDM2	Organism	Human
Genome Locus	chr1:14057494-14068652:+	Build	hg19
Disease	Hepatocellular Carcinoma	ICD-10	Liver cell carcinoma (C22.0)
DBLink	Link to database	PMID	28410211
Experimental Method
Sample Type	TissueS HepG2, SMMC7721, Huh7, MHCC97L, MHCC97H, HCCLM3 Cell lines	Comparison	HCC tissues and paired adjacent nontumorous tissues
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GAAACTGGCTGCGATATGTG Reverse CACAGGCTCAGTAGTGTTCTTTAAA	Statistics	Fold Change : Downregulated,2.94 pvalue : p< 0.001
Citation
Fu, L, Chen, Q, Yao, T, Li, T, Ying, S, Hu, Y, Guo, J (2017). Hsa_circ_0005986 inhibits carcinogenesis by acting as a miR-129-5p sponge and is used as a novel biomarker for hepatocellular carcinoma. Oncotarget, 8, 27:43878-43888.